Strumigenys emmae (Emery, 1890)

Primary tabs

EOL Text

Taxonomic History:
Epitritus emmae Emery, 1890c PDF: 70, pl. 8, fig. 6 (w.) ANTILLES. AntCat AntWiki

Taxonomic history

Wheeler, 1908a PDF: 149 (q.).
Combination in Quadristruma: Brown, 1949b: 48; in Strumigenys: Bolton, 1999 PDF: 1674.
Senior synonym of Strumigenys clypeatus, Strumigenys malesiana, Strumigenys wheeleri: Brown, 1949b: 48.
See also: Bolton, 1983 PDF: 400; Bolton, 2000: 950.
Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=strumigenys&name=emmae&rank=species

Distribution:

Cabo Verde

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=strumigenys&name=emmae&rank=species

Statistics of barcoding coverage: Strumigenys emmae:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 56
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=59496

Strumigenys emmae:

Strumigenys emmae is a species of ant in the genus Strumigenys.[1] It is 1.5 millimeters long and is yellowish brown, has a 4 segmented antennae, small eyes, and has hairs on the head, mesosoma, and petiole that are mostly scale-like or orbicular. They are difficult to find other than when encountered in leaf litter samples or pitfall traps. They are normally slow moving, but they can move fast when disturbed. The species first strike usually kills its prey. The species colony is small. It is most often found in beach margins and agricultural areas.[citation needed]

References[edit]

  1. ^ Bolton, B. (2015). "Strumigenys emmae". AntCat. Retrieved 14 February 2015. 
Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorWikipedia
Sourcehttp://en.wikipedia.org/w/index.php?title=Strumigenys_emmae&oldid=654483918

Barcode data: Strumigenys emmae:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATACTTCATTTTAGCCATTTGATCTGGTATAATTGGATCATCTATAAGAATGATTATTCGGTTAGAATTAGGAACTTGTAATTCTTTAATTAATAATGATCAAATTTATAATTCTTTAGTAACTAATCACGCCCTAATTATAATTTTTTTTATAATTATACCTTTTATAATTGGTGGATTTGGAAATTTTTTAATCCCTTTAATAATTGGATCTCCTGATATAGCATATCCTCGTATAAATAATATAAGATTTTGATTACTCCCACCTTCTTTAATACTTCTAATATCAAGAAATTTTATTAATGAAGGTGTTGGTACTGGATGAACTATTTATCCTCCATTATCTTCTAATATTTTTCATAATGGTCCATCTATTGACCTAGCCATTTTCTCTCTTCATATTGCTGGAATATCTTCTATTTTAGGAGCAATTAATTTTATTTCAACTATTATTAATATACATAATTCTAATATTTCTATAGATAAAATTTCTTTATTATCCTGATCAATTATAATTACAGCTATTCTTCTCCTTCTTTCTCTACCTGTATTAGCAGGAGCTATTACTATATTACTTACTGATCGTAATTTAAATACTTCATTTTTTGATCCCTCAGGTGGGGGTGATCCTATTCTTTTTCAACATTTATTT
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=59496

Strumigenys hexamera

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/node/32673

Diagnosis of worker among Antkey species. Head shape triangular. Antenna 6-sgemented. Antennal club 2-segmented. Antennal scapes not conspicuously short; easily extended beyond eye level. Antennal insertions at least partly covered by frontal lobes. Eyes medium to large (greater than 5 facets); situated on lower margin of scrobe. Frontal lobes do not obscure face outline between mandible and eye. Posterolateral corners of head unarmed, without spines. Mandibles linear; armed with apical fork. Pronotal spines absent. Propodeum armed with spines or teeth. Waist 2-segmented. Petiole and postpetiole with distinct spongiform. Appressed circular hairs cover face, mesosoma and waist segments.

Strumigenys emmae can be separated from other introduced and commonly intercepted Strumigenys species by the following combination of characters: (1) mandibles linear; (2) mandibles with apical fork, not denticles; (3) appressed circular hairs cover face, mesosoma and waist segments; (4) spongiform on petiole and postpetiole. Strumigenys hexamera is superficially similar because it also has appressed circular hairs, but S. emmae is easily distinguished by the mandibles armed with an apical fork (versus denticles).

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/node/32673
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith