Anochetus mayri Emery 1884

Primary tabs

EOL Text

Anochetus Mayri HNS n.sp.

Credo utile far seguire un quadro sinottico delle specie del genere Anochetus HNS , del quale, oltre la specie descritta sopra, segnalero tre altre forme nuove, per cui il numero delle specie conosciute trovasi portato da cinque a nove, che ho vedute tutte in natura, fuorche l' A. Nietneri Rog. HNS : le forme nuove saranno descritte in altro luogo.

A. Mandibole terminate con tre denti distinti, dei quali l' intermedio piu piccolo.

a. Squama del picciuolo troncata superiormente o bidentata, metanoto con due denti.

- Squama con due denti.... A. Mayri HNS n. sp. (Antille: s. Tommaso).

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/7397373894014741704E04F3C6633D21

Overview:

Anochetus mayri is native to the Neotropics, where it is widespread across the Caribbean, Central America and South America. The species is introduced in Florida, and is the only member of its genus known to have become successfully established outside of its native range. This small and presumably predaceous trap-jaw species is most often found in leaf litter, and is recognized by its long linear mandibles, single waist segment and bicuspidate petiolar node. This latter character, along with its much smaller size and lack of a nuchal carinae, easily allow A. mayri to be distinguished by its sister genus, Odontomachus. While it may be capable of stinging humans, the species is not aggressive or strongly defensive, and is unlikely to become a significant economic pest or have significant impacts on the native fauna. 

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=anochetus&name=mayri&rank=species

[41] Anochetus mayri HNS

Anochetus HNS of the mayri complex are the common small members of the genus in the New World, corresponding to A. katonae HNS in Africa, and perhaps to A. graeffei HNS in the Indo-Australian region. Like these species, A. mayri HNS is variable in body size, eye size, antenna! scape length, color and sculpture, as well as size and details of form and dentition of the mandibles. It is not always easily separated from smaller specimens of the inermis HNS complex on the one hand, or from neglectus HNS on the other, and some of the variation raises the suspicion that mayri HNS may include two or more sibling species.

A. mayri was first proposed in a key, without a proper description, from a specimen from St. Thomas ' in the West Indies. It was never described in full by Emery, so when Wheeler described the subspecies laeviuscula , he did not know what the «typical»mayri HNS was like. In fact, we still have no clear idea of what the color, sculpture, etc, of the mayri HNS type really are, owing to the present difficulties of studying the material of the Emery Collection in Genoa. But we do know that the mayri HNS complex is widespread in the West Indies and shows there wide variation in size, color and sculpture, including samples with predominantly smooth and some with completely striate pronota, as well as intermediates. After prolonged study of this material, I cannot find any way to separate it into two species, or even into reasonably clearcut geographical forms, so I assume that mayri HNS and laeviusculus HNS are synonyms.

On the mainland, the situation is more complex, because the variation is more extensive. The Atlantic lowland forest of Costa Rica, for example, contains a larger, dark brown form (HL 1.05- 1.08, HW 0.92-0.94, ML 0.57-0.58, eye L 0.13 mm) with punctulate-striate sculpture weak in the middle of the pronotum, and weakly shining, but still not completely smooth. Sympatric in this area (for instance, at Rio Toro Amarillo, near Guapiles, Limon Prov.) is a smaller (HL 0.93, HW 0.82, ML 0.48, eye L 0.10-0.11 mm) brown- ish-yellow phenon with completely longitudinally striate pronotum. Whether these forms are conspecific or not cannot be decided without more evidence from this locality, but there are available intermediates among samples from elsewhere in the range, which extends from the Veracruz lowlands of Mexico through Central America and the West Indies to hylean South America, at least as far south as the Beni River drainage of Bolivia, and on the west slope of the Andes to southern Ecuador.

South and east of the Amazon drainage in Brazil occurs a rather uniform mayri-complex phenon that is usually dull yellowish-brown in color, has finely striolate cephalic dorsum and sericeous-striolate or densely punctulate pronotum (the striation barely resolved at 50X). This form, which closely resembles certain variants from the West Indies, corresponds to the named varieties or subspecies neglectus HNS , australis HNS and nobilis HNS , which I regard as synonyms. My instincts are to extend the synonymy by placing all 3 names under mayri HNS , since no satisfactory characters have been found to separate neglectus HNS from all samples of mayri HNS , and this would be the preferred action here were it not for two stubborn facts:

First, the neglectus HNS phenon is widespread and the only form over a wide area of central and southern Brazil, Uruguay and northern Argentina (and presumably Paraguay). It ranges at least from Pernambuco (Caruaru, B. Pickel), [central?] Mato Grosso, and Minas Gerais (Belo Horizonte, J. C. Bradley) southward to Santa Fé Prov. in N central Argentina. Over this range, the eyes are relatively fairly large (eye L 0.13-0.16 mm), and the mesopleura are sculptured throughout, though their lower middle portions are slightly shining. Most similar samples from the Caribbean area have smooth, shining areas on the mesopleura, and the eyes are smaller.

Second , several males of undoubted Anochetus HNS taken at light on 14 Nov. 1964 at Piracicaba, São Paulo State (C. Triplehorn), and about the right size to match mayri-complex workers, have terminalia radically different from those of males (figs. 70, 71) associated with mayri-complex workers taken in a nest from near Turrialba, Costa Rica (W. L. Brown). Males taken at light during June 1975 at Tinalandia, on the western slope of the Andes in Pichincha Prov., Ecuador (S. and J. Peck) are very similar to the Turrialba sample, at least as seen undissected. The Piracicaba males have broad-based, convex parameres that are suddenly constricted near midlength, and then each is continued as a slender, lanceolate, apical blade that is weakly concave facing laterad, so that when the terminalia are viewed end-on, the parameral apices are curved slightly away from the midline. The volsellae are also longer in the Piracicaba males, but the sharp apices of the aedeagal valves are shorter than those of the northern males.

We do not know for sure, of course, what kind of workers belong with the Piracicaba males, but the only right-sized workers that we know to occur in the area are those I call here neglectus HNS . As long as there is a chance that these southern males do belong with neglectus HNS workers, it will be necessary to recognize the latter name, even in the absence of absolute diagnostic characters for workers and queens.

As in other groups of Anochetus HNS , the mayri HNS complex will not be completely clarified until we have adequate samples of workers or queens associated in the nest with males.

A. mayri HNS is found mostly in forests under stones, in moss on rocks or logs, in rotten twigs on the forest floor, or in larger bodies of rotten wood. The workers and queen feign death, and are difficult to see.

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/38C790923FF797EE083BB1D2F896120F

Biology:

 Untitled Document    

Anochetus mayri was placed together with A. neglectus and A. minas into the A. mayri-group by Brown (1978), which he described as small species with squamiform, emarginate or bicuspidate petiolar nodes. Brown commented that the high variability of A. mayri with respect to body size, eye size, antennal scape length, color and sculpture, as well as size and details of form and dentition of the mandibles, raises the suspicion that A. mayri may include two or more sibling species. Brown therefore adopted the convention of referring to the A. mayri complex.

  A native to the Neotropics, A. mayri is widespread across the Caribbean, Central America and South America. The species was first reported from Dade County, Florida in 1987 (Deyrup et al., 2000) based on a single dealate queen. As of 2002, A. mayri was found to be thriving at a site in Palm Beach County, where it was found together with many other introduced ants species throughout leaf litter samples taken at the bases of pines and oaks (Deyrup, 2002). The species appears to be confined to disturbed habitats in its introduced range, where it forages in subterranean microhabitats for prey. Deyrup (2002) reports that while it may be capable of stinging humans, the species is not aggressive or strongly defensive, and is unlikely to become a significant economic pest or have significant impacts on the native fauna.

 Brown (1978) reported A. mayri as being found mostly in forests under stones, in moss on rocks or logs, in rotten twigs on the forest floor, or in larger bodies of rotten wood. He also observed that the workers and queen feign death, and are difficult to see.    

From Jack Longino (Ants of Costa Rica)
Anochetus are presumably predators, using their snapping mandibles much like their larger relatives, Odontomachus. However, there are few direct observations. "A. mayri is found mostly in forests under stones, in moss on rocks or logs, in rotten twigs on the forest floor, or in larger bodies of rotten wood. The workers and queen feign death, and are difficult to see (Brown 1978)." There appear to be two distinct forms in the Atlantic lowlands of Costa Rica, one of which may be more arboreal.

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=anochetus&name=mayri&rank=species

Anochetus mayri is native to the Neotropics, where it is widespread across the Caribbean, Central America and South America. The species is introduced in Florida, and is the only member of its genus known to have become successfully established outside of its native range. This small and presumably predaceous trap-jaw species is most often found in leaf litter, and is recognized by its long linear mandibles, single waist segment and bicuspidate petiolar node. This latter character, along with its much smaller size and lack of a nuchal carina, easily allow A. mayri to be distinguished by its sister genus, Odontomachus. While it may be capable of stinging humans, the species is not aggressive or strongly defensive, and is unlikely to become a significant economic pest or have significant impacts on the native fauna. 

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/node/32585

Distribution:

Native Range. Veracruz lowlands of Mexico through Central America and the West Indies to hylean South America, at least as far south as the Beni River drainage of Bolivia, and on the west slope of the Andes to southern Ecuador (Brown 1978). Costa Rica: wet forest in Atlantic lowlands to 800m elevation.

Introduced Range. USA Florida: Homestead (Dade Co.); south Miami (Dade Co.); West Palm Beach (Palm Beach Co.).

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=anochetus&name=mayri&rank=species

Diagnosis of worker among Antkey species. Antenna 12-segmented. Eyes large and situated distinctly below midline of head. Posterior margin of head uninterrupted by median longitudinal groove. Frontal lobes present. Clypeus with anterior margin flat to convex, but never forming a distinct triangle that projects anteriorly beyond the base of the mandibles. Mandibles linear, inserted towards the middle of the anterior head margin, armed with apical fork. Waist 1-segmented. Petiole narrowly attached to gaster and with a conspicuous posterior face. Petiolar node bicuspidate, excised medially to form a pair of dorsolateral spines. Gaster armed with sting. Dark brown to yellowish-brown.
 

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/node/32585

Identification:

Diagnosis among introduced species
Antenna 12-segmented. Eyes large and situated distinctly below midline of head. Posterior margin of head uninterrupted by median longitudinal groove. Frontal lobes present. Clypeus with anterior margin flat to convex, but never forming a distinct triangle that projects anteriorly beyond the base of the mandibles. Mandibles linear, inserted towards the middle of the anterior head margin, armed with apical fork. Waist 1-segmented. Petiole narrowly attached to gaster and with a conspicuous posterior face. Petiolar node bicuspidate, excised medially to form a pair of dorsolateral spines. Gaster armed with sting. Dark brown to yellowish-brown.

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=anochetus&name=mayri&rank=species

Statistics of barcoding coverage: Anochetus mayri:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 26
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=80921

Barcode data: Anochetus mayri:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GCAATTTGAGCTGGAATAATTGGTTCTTCTATAAGAATATTAATTCGTTTAGAATTAGGAACATGTAATTCTTTAATTTTAAAT---GATCAAATTTATAATACATTAATTACAAGTCATGCATTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGTTTTGGAAATTATTTAGTTCCATTAATATTAGGATCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCACCTTCATTAATTTTATTAATTTCAAGAAGTTTAACCTTTCAGGGAACAGGAACTGGATGAACTGTTTATCCTCCTTTATCTAATAATTTATATCATAATGGATTTTCTACTGATTTGGCAATTTTTTCATTACATATTGCTGGAATATCTTCAATCATAGGTGCAATTAATTTTATTTCTACTATTTTAAATATACATCATAAAAATTTAACTTTAGAAAAAATTTCTTTATTAGTTTGATCAATTTTAATTACTGCAATTTTATTATTATTATCATTACCTGTTTTAGCCGGTGCAATTACAATATTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTTCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAAGAATCTTTTGGATCTTTAGGTATAATTTATGCAATGATAGCAATTGGATTTTTAGGATTTATTGTATGGGCTCATCATATATTTACAGTTGGAATAGATATTGATACACGAG
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=80921
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith