Ochetellus glaber (Mayr, 1862)

Primary tabs

EOL Text

Taxonomic History:

3 subspecies

Hypoclinea glabra Mayr, 1862 PDF: 705 (w.m.) AUSTRALIA. AntCat AntWiki

Taxonomic history

Mayr, 1876 PDF: 81 (q.); Crozier, 1969a PDF: 251 (k.); Wheeler & Wheeler, 1974b PDF: 398 (l.).
Combination in Iridomyrmex: Mayr, 1865: 61; in Ochetellus: Shattuck, 1992a PDF: 17.
Senior synonym of Ochetellus itoi: Wu & Wang, 1995a: 124.
See also: Brown, 1958h: 40.
Current subspecies: nominal plus Ochetellus glaber clarithorax, Ochetellus glaber consimilis, Ochetellus glaber sommeri.
Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=ochetellus&name=glaber&rank=species

Distribution:

North Island and Nelson

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=ochetellus&name=glaber&rank=species

Barcode data: Ochetellus glaber:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCAATTTGATCAGGAATAATTGGTTCTTCAATAAGAATAATTATCCGATTAGAATTAGGAACATGTAATTCTGTTATTATAGAC---GATCAAATTTATAATTCTATTGTAACTAGACATGCCTTTATCATAATTTTTTTTATAGTTATACCTTTTATAATCGGAGGATTTGGAAATTTTTTAGTACCTTTAATACTAGGAGCCCCTGATATAGCTTATCCACGAATAAATAATATAAGATTCTGATTATTACCGCCATCAATTTTATTATTAACCATTAGAAATTTTATCAGATCAGGAGTAGGAACAGGATGAACTGTTTATCCTCCCTTAGCAAGAAATATATTTCACAATGGACCATCTGTAGATTTAGCTATTTTTTCTTTACATATTGCTGGAATATCATCAATTTTAGGAGCAATTAATTTTATTTCAACTATTCTAAACATACATCATAAAAATTTCTCTATAGATAAAATTCCTCTATTAGTTTGATCAATCTTAATTACTGCTGTACTATTACTCTTATCTTTACCAGTATTAGCAGGAGCAATTACTATGCTTCTAACTGATCGAAACTTAAATACTTCCTTTTTTGATCCATCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTTTGATTTTTTGGACACCCAGAGGTTTATATCTTAATTTTACCAGGATTTGGACTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTTGGATCCTTAGGAATAATTTATGCTATAATTGCCATTGGATTCTTGGGATTTGTAGTATGGGCCCACCATATATTTACTATTGGGTTAGATGTAGATACCCGTG
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=82293

Statistics of barcoding coverage: Ochetellus glaber:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=82293

Ochetellus glaber:

Ochetellus glaber (black house ant) is a species of ant. The species are found in both urban and rural areas in Australia, and usually nest under stones or dry logs. The species can commonly be found in gardens.[1] The adult ants usually grow to 2.5 mm to 3 mm long.[citation needed]

Black house ants live in coexistent relationships with other common suburban ants, like the green-head ant, however, they can be aggressive towards other species if disturbed. They are omnivorous, feeding on insects and worms, as well as vegetation, such as small seeds.[citation needed]

References[edit]

  1. ^ "Ochetellus glaber (Mayr)". Land Care Research. Retrieved 2009-12-21. 
Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorWikipedia
Sourcehttp://en.wikipedia.org/w/index.php?title=Ochetellus_glaber&oldid=654488230

Diagnosis of worker among Antkey species. Antenna 12-segmented. Antennal scape length less than 1.5x head length. Antennal sockets and posterior clypeal margin separated by a distance less than the minimum width of antennal scape. Eyes medium to large (greater than 6 facets); do not break outline of head. Dorsum of mesosoma with distinct metanotal groove, but never with a deep and broad concavity; lacking erect hairs. Propodeum with distinct and posteriorly projecting protrusion causing declivity to be strongly concave. Waist 1-segmented. Petiole upright and not appearing flattened. Gaster armed with ventral slit. Distinct constriction not visible between abdominal segments 3+4. Color uniformly brown to black.

The Ochetellus glaber group is easily recognized among introduced and commonly intercepted dolichoderines by the unique shape of the propodeum which forms a blunt, posteriorly projecting knob and caused a noticeably concave declivity. Species in this group are most likely confused with Dolichoderus species, but can be separated by the lack of a deep and broad concavity separating the promesonotum from the propodeum, and also by the presence of erect hairs on the mesosomal dorsum.

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/content/ochetellus-glaber-1

Dolichoderus thoracicus

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/node/32645

Diagnosis of worker among Antkey species. Antenna 12-segmented. Antennal scape length less than 1.5x head length. Antennal sockets and posterior clypeal margin separated by a distance less than the minimum width of antennal scape. Eyes medium to large (greater than 6 facets); do not break outline of head. Dorsum of mesosoma with distinct metanotal groove, but never with a deep and broad concavity; lacking erect hairs. Propodeum with distinct and posteriorly projecting protrusion causing declivity to be strongly concave. Waist 1-segmented. Petiole upright and not appearing flattened. Gaster armed with ventral slit. Distinct constriction not visible between abdominal segments 3+4. Color uniformly brown to black.

The Ochetellus glaber group is easily recognized among introduced and commonly intercepted dolichoderines by the unique shape of the propodeum which forms a blunt, posteriorly projecting knob and caused a noticeably concave declivity. Species in this group are most likely confused with Dolichoderus species, but can be separated by the lack of a deep and broad concavity separating the promesonotum from the propodeum, and also by the presence of erect hairs on the mesosomal dorsum.

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/node/32645
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith