Tetramorium bicarinatum (Nylander, 1846)

Primary tabs

EOL Text

Taxonomic History:
Myrmica bicarinata Nylander, 1846b PDF: 1061 (w.q.) U.S.A. AntCat AntWiki

Taxonomic history

Forel, 1891c PDF: 151 (m., misidentified as Tetramorium guineense); Wheeler & Wheeler, 1954d PDF: 449 (l., misidentified as Tetramorium guineense); guineense Fabr. Psyche (Cambridge) 31:136-137. [1924-08]">Wheeler, 1924d PDF: 136 (gynandromorph, misidentified as Tetramorium guineense).
Combination in Tetramorium: Mayr, 1862 PDF: 740; Bolton, 1977 PDF: 94.
Junior synonym of Formica guineensis Fabricius, 1793 PDF: 357 (now in Pheidole): Mayr, 1862 PDF: 740.
Revived from synonymy and senior synonym of Tetramorium cariniceps (and its junior synonym Tetramorium kollari), Tetramorium modesta Smith, Tetramorium reticulata: Bolton, 1977 PDF: 94.
[Note. The names Tetramorium cariniceps, Tetramorium kollari and Tetramorium reticulata had previously been incorrectly synonymised with Tetramorium guineensis Fabricius by Roger, 1862c PDF: 293; Tetramorium modesta Smith was wrongly synonymised with Tetramorium guineensis by Donisthorpe, 1932c PDF: 463.].
See also: Bolton, 1979 PDF: 164; Mayr (Hymenoptera: Formicidae) in the Malagasy region—introduction, definition of species groups, and revision of the T. bicarinatum, T. obesum, T. sericeiventre and T. tosii species groups. Zootaxa 3039:1-72. [2011-09-22]">Hita Garcia & Fisher, 2011 PDF: 18.
Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=tetramorium&name=bicarinatum&rank=species

Distribution:

One record from Wallonia, only indoors

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=tetramorium&name=bicarinatum&rank=species

Taxonomic Treatment:

Ward, P. S., 2005:
 I [introduced species]
  Bolton, B., 1979:
 (Figs 39, 43, 47)
 Myrmica bicarinata Nylander , 1846: 1061. Syntype workers, female, U. S. A.: California, 1840 (types lost). Tetramorium bicarinatum (Nylander) ; Mayr, 1862: 740. [For a full statement of the current synonymy of bicarinatum , application of the name and discussion of the species see Bolton, 1977: 94.]
 Worker . TL 3.4 - 4.5, HL 0.80 - 1.00, HW 0.68 - 0.86, CI 80 - 87, SL 0.54 - 0.68, SI 75 - 84, PW 0.50 - 0.62, AL 0.94 - 1.20 (114 measured).
 Mandibles very finely and densely longitudinally striate; extremely rarely the mandibles appearing finely shagreened. Anterior clypeal margin with a marked median notch or impression. Median portion of clypeus with three longitudinal carinae of about equal strength, a median and one on each side. Sometimes another carina present on each side of the median but these are very feeble by comparison and nearly always incomplete or broken. Frontal carinae strong, running back almost to the occiput and equipped above with a narrow, raised semitranslucent rim or flange. Eyes relatively large, maximum diameter c. 0.19 - 0.24 so that diameter of eye is 0.26 - 0.29 x HW. Pronotal angles sharp in dorsal view. Metanotal groove absent but some specimens with a shallow impression in the alitrunk outline at its approximate position. Propodeal spines in profile strong and acute, moderately long, varying from more or less straight to slightly upcurved along their length. Metapleural lobes elongate-triangular and upcurved. Petiole node in profile roughly rectangular, with parallel or almost parallel anterior and posterior faces and an evenly convex dorsum which meets each face in an angle. The anterodorsal and posterodorsal angles of the node in profile are on a level as the dorsum of the node does not slope upward posteriorly. Dorsum of head with scattered irregular longitudinal rugae with a few cross-meshes but behind the level of the eyes with a strong rugoreticulum (Fig. 47). Ground-sculpture between the rugae superficial and inconspicuous. Dorsum of alitrunk, petiole and postpetiole reticulate-rugose, the sides of the pedicel segments similarly sculptured. Gaster unsculptured for the most part but nearly always with some short, fine, basal costulae on the first tergite. These may be very faint but are only rarely completely absent. All dorsal surfaces with numerous erect or suberect hairs, those projecting from the dorsum of the frontal carinae between the antennal insertions and the occipital corner relatively short (by comparison with other species of the group), shorter than the maximum diameter of the eye. Head, alitrunk, petiole and postpetiole varying from light yellow-brown to bright orange-yellow, the gaster always much darker, deep brown or blackish brown.
 T. bicarinatum is a highly successful tramp species which appears to have originated in SE Asia. It is now reasonably common throughout the tropical and subtropical zones of the world except for the Ethiopian region, from which it is unknown. In temperate zones bicarinatum is capable of establishing itself in hothouses, conservatories and other constantly heated buildings.
  It is the only member of its group to be found in Madagascar, but in the New World two closely related species also occur as introductions. These are pacificum and insolens , both of which differ from bicarinatum in having the mandibles smooth and shining. In addition to this, the petiole node is very differently shaped in pacificum (compare Figs 43 and 44) and the ant is uniformly dark brown or black in colour. T. insolens also differs in colour from bicarinatum , having the gaster the same colour or lighter than the head and alitrunk, and in addition having relatively much longer hairs on the dorsum of the frontal carinae, which are distinctly longer than the maximum diameter of the eye (compare Figs 39 and 40).
  For a full list of material previously examined see Bolton (1977: 96). In this study I have examined material of the Neotropical region from Mexico, Trinidad, Cuba, Puerto Rico, Antigua, Dominican Republic, Barbados, Haiti, Panama, Costa Rica, Honduras, Nicaragua, Venezuela, Colombia, Bolivia, Guiana, Brazil and Peru, which indicates that bicarinatum is fairly well established in the neotropics. Material from North America has been seen from the Bahamas, Florida, New York, Ohio, Wisconsin, Illinois, Georgia, Texas, W. Virginia, California. The majority of this material is deposited in USNM, Washington; MCZ, Cambridge; LACM, Los Angeles; BMNH.
 

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=tetramorium&name=bicarinatum&rank=species

I [introduced species]

License
Rights holder/AuthorNo known copyright restrictions
Sourcehttp://antbase.org/ants/publications/21008/21008.pdf

(Figs 39, 43, 47)

 

Myrmica bicarinata Nylander , 1846: 1061. Syntype workers, female, U. S. A.: California, 1840 (types lost). Tetramorium bicarinatum (Nylander) ; Mayr, 1862: 740. [For a full statement of the current synonymy of bicarinatum , application of the name and discussion of the species see Bolton, 1977: 94.]

 

Worker . TL 3.4 - 4.5, HL 0.80 - 1.00, HW 0.68 - 0.86, CI 80 - 87, SL 0.54 - 0.68, SI 75 - 84, PW 0.50 - 0.62, AL 0.94 - 1.20 (114 measured).

 

Mandibles very finely and densely longitudinally striate; extremely rarely the mandibles appearing finely shagreened. Anterior clypeal margin with a marked median notch or impression. Median portion of clypeus with three longitudinal carinae of about equal strength, a median and one on each side. Sometimes another carina present on each side of the median but these are very feeble by comparison and nearly always incomplete or broken. Frontal carinae strong, running back almost to the occiput and equipped above with a narrow, raised semitranslucent rim or flange. Eyes relatively large, maximum diameter c. 0.19 - 0.24 so that diameter of eye is 0.26 - 0.29 x HW. Pronotal angles sharp in dorsal view. Metanotal groove absent but some specimens with a shallow impression in the alitrunk outline at its approximate position. Propodeal spines in profile strong and acute, moderately long, varying from more or less straight to slightly upcurved along their length. Metapleural lobes elongate-triangular and upcurved. Petiole node in profile roughly rectangular, with parallel or almost parallel anterior and posterior faces and an evenly convex dorsum which meets each face in an angle. The anterodorsal and posterodorsal angles of the node in profile are on a level as the dorsum of the node does not slope upward posteriorly. Dorsum of head with scattered irregular longitudinal rugae with a few cross-meshes but behind the level of the eyes with a strong rugoreticulum (Fig. 47). Ground-sculpture between the rugae superficial and inconspicuous. Dorsum of alitrunk, petiole and postpetiole reticulate-rugose, the sides of the pedicel segments similarly sculptured. Gaster unsculptured for the most part but nearly always with some short, fine, basal costulae on the first tergite. These may be very faint but are only rarely completely absent. All dorsal surfaces with numerous erect or suberect hairs, those projecting from the dorsum of the frontal carinae between the antennal insertions and the occipital corner relatively short (by comparison with other species of the group), shorter than the maximum diameter of the eye. Head, alitrunk, petiole and postpetiole varying from light yellow-brown to bright orange-yellow, the gaster always much darker, deep brown or blackish brown.

 

T. bicarinatum is a highly successful tramp species which appears to have originated in SE Asia. It is now reasonably common throughout the tropical and subtropical zones of the world except for the Ethiopian region, from which it is unknown. In temperate zones bicarinatum is capable of establishing itself in hothouses, conservatories and other constantly heated buildings.

 

It is the only member of its group to be found in Madagascar, but in the New World two closely related species also occur as introductions. These are pacificum and insolens , both of which differ from bicarinatum in having the mandibles smooth and shining. In addition to this, the petiole node is very differently shaped in pacificum (compare Figs 43 and 44) and the ant is uniformly dark brown or black in colour. T. insolens also differs in colour from bicarinatum , having the gaster the same colour or lighter than the head and alitrunk, and in addition having relatively much longer hairs on the dorsum of the frontal carinae, which are distinctly longer than the maximum diameter of the eye (compare Figs 39 and 40).

 

For a full list of material previously examined see Bolton (1977: 96). In this study I have examined material of the Neotropical region from Mexico, Trinidad, Cuba, Puerto Rico, Antigua, Dominican Republic, Barbados, Haiti, Panama, Costa Rica, Honduras, Nicaragua, Venezuela, Colombia, Bolivia, Guiana, Brazil and Peru, which indicates that bicarinatum is fairly well established in the neotropics. Material from North America has been seen from the Bahamas, Florida, New York, Ohio, Wisconsin, Illinois, Georgia, Texas, W. Virginia, California. The majority of this material is deposited in USNM, Washington; MCZ, Cambridge; LACM, Los Angeles; BMNH.

License
Rights holder/AuthorNo known copyright restrictions
Sourcehttp://atbi.biosci.ohio-state.edu/HymOnline/reference-full.html?id=6435

Statistics of barcoding coverage: Tetramorium bicarinatum:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 105
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=52721

Barcode data: Tetramorium bicarinatum:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTCTTTATTTTTTATTTGCTATTTGAGCTGGAATAATTGGATCTTCAATAAGAATGATTATTCGATTAGAATTAGGATCATGTGATTCAATTATTAATAATGATCAAATTTATAATACTTTAGTAACAAGACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGGGGATTTGGAAATTTTTTAGTTCCTTTAATATTAGGAACTCCAGATATAGCCTATCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTATTATATTATTATTATTTAGAAGATTTATTAATATAGGAGTAGGTACTGGATGAACTATTTATCCTCCATTAGCTTCAAATATTTTTCATAGAGGACCCTCAGTAGATATATCGATTTTTTCCCTTCATATTGCAGGTATATCATCCATTTTAGGAGCTATTAATTTTATTTCTACTATTTTAAATATACATCATAAAAAACTATCTTTAGATAAAATTCCATTATTAGTATGATCTATTTTAATTACAGCCATTTTATTATTATTATCATTACCAGTATTAGCCGGAGCTATTACTATACTTCTAACAGATCGAAACTTAAACACTTCATTCTTTGATCCTTCTGGAGGAGGAGACCCAATCTTATATCAACATTTATTT
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=52721

Tetramorium bicarinatum (Nylander) HNS

(Figs 39, 43, 47)

Myrmica bicarinata Nylander HNS , 1846: 1061. Syntype workers, female, U. S. A.: California, 1840 (types lost). Tetramorium bicarinatum (Nylander) HNS ; Mayr, 1862: 740. [For a full statement of the current synonymy of bicarinatum HNS , application of the name and discussion of the species see Bolton, 1977: 94.]

Worker . TL 3.4 - 4.5, HL 0.80 - 1.00, HW 0.68 - 0.86, CI 80 - 87, SL 0.54 - 0.68, SI 75 - 84, PW 0.50 - 0.62, AL 0.94 - 1.20 (114 measured).

Mandibles very finely and densely longitudinally striate; extremely rarely the mandibles appearing finely shagreened. Anterior clypeal margin with a marked median notch or impression. Median portion of clypeus with three longitudinal carinae of about equal strength, a median and one on each side. Sometimes another carina present on each side of the median but these are very feeble by comparison and nearly always incomplete or broken. Frontal carinae strong, running back almost to the occiput and equipped above with a narrow, raised semitranslucent rim or flange. Eyes relatively large, maximum diameter c. 0.19 - 0.24 so that diameter of eye is 0.26 - 0.29 x HW. Pronotal angles sharp in dorsal view. Metanotal groove absent but some specimens with a shallow impression in the alitrunk outline at its approximate position. Propodeal spines in profile strong and acute, moderately long, varying from more or less straight to slightly upcurved along their length. Metapleural lobes elongate-triangular and upcurved. Petiole node in profile roughly rectangular, with parallel or almost parallel anterior and posterior faces and an evenly convex dorsum which meets each face in an angle. The anterodorsal and posterodorsal angles of the node in profile are on a level as the dorsum of the node does not slope upward posteriorly. Dorsum of head with scattered irregular longitudinal rugae with a few cross-meshes but behind the level of the eyes with a strong rugoreticulum (Fig. 47). Ground-sculpture between the rugae superficial and inconspicuous. Dorsum of alitrunk, petiole and postpetiole reticulate-rugose, the sides of the pedicel segments similarly sculptured. Gaster unsculptured for the most part but nearly always with some short, fine, basal costulae on the first tergite. These may be very faint but are only rarely completely absent. All dorsal surfaces with numerous erect or suberect hairs, those projecting from the dorsum of the frontal carinae between the antennal insertions and the occipital corner relatively short (by comparison with other species of the group), shorter than the maximum diameter of the eye. Head, alitrunk, petiole and postpetiole varying from light yellow-brown to bright orange-yellow, the gaster always much darker, deep brown or blackish brown.

T. bicarinatum HNS is a highly successful tramp species which appears to have originated in SE Asia. It is now reasonably common throughout the tropical and subtropical zones of the world except for the Ethiopian region, from which it is unknown. In temperate zones bicarinatum HNS is capable of establishing itself in hothouses, conservatories and other constantly heated buildings.

It is the only member of its group to be found in Madagascar, but in the New World two closely related species also occur as introductions. These are pacificum HNS and insolens HNS , both of which differ from bicarinatum HNS in having the mandibles smooth and shining. In addition to this, the petiole node is very differently shaped in pacificum HNS (compare Figs 43 and 44) and the ant is uniformly dark brown or black in colour. T. insolens HNS also differs in colour from bicarinatum HNS , having the gaster the same colour or lighter than the head and alitrunk, and in addition having relatively much longer hairs on the dorsum of the frontal carinae, which are distinctly longer than the maximum diameter of the eye (compare Figs 39 and 40).

For a full list of material previously examined see Bolton (1977: 96). In this study I have examined material of the Neotropical region from Mexico, Trinidad, Cuba, Puerto Rico, Antigua, Dominican Republic, Barbados, Haiti, Panama, Costa Rica, Honduras, Nicaragua, Venezuela, Colombia, Bolivia, Guiana, Brazil and Peru, which indicates that bicarinatum HNS is fairly well established in the neotropics. Material from North America has been seen from the Bahamas, Florida, New York, Ohio, Wisconsin, Illinois, Georgia, Texas, W. Virginia, California. The majority of this material is deposited in USNM, Washington; MCZ, Cambridge; LACM, Los Angeles; BMNH.

  • Bolton, B. (1979): The ant tribe Tetramoriini (Hymenoptera: Formicidae). The genus Tetramorium Mayr in the Malagasy region and in the New World. Bulletin of the British Museum (Natural History) Entomology 38, 129-181: 164-165, URL:http://atbi.biosci.ohio-state.edu/HymOnline/reference-full.html?id=6435
LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/290B5665AF4E8C1380337FD064E3242E

Tetramorium bicarinatum (Nylander HNS 1846b)

I [introduced species]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/582DADF5ED0851799AED036248548347

Tetramorium bicarinatum is a medium-sized ant with a reddish head, mesosoma and waist contrasting with a dark gaster. This species has a monomorphic worker caste with 12-segmented antennae, three-segmented antennal club, antennal scrobes, short antennal scapes that do not surpass the posterior margin of the head, a gradually sloped mesosoma, and strong propodeal spines. Like all myrmicines, T. bicarinatum has two waist segments and a gaster armed with a stinger. In the field it can be recognized by its bicolored appearance, medium size and strong recruiting to baits and food resources.Tetramorium bicarinatum is believed to be native to Africa, but is now widely distributed across the Pacific and other tropical regions. The species can achieve dense populations in disturbed habitats and is likely to adversely affect native biodiversity.

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/content/tetramorium-bicarinatum-2
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith