Tetramorium pacificum Mayr, 1870

Primary tabs

EOL Text

Taxonomic History:
Tetramorium pacificum Mayr, 1870b PDF: 976 (w.q.) TONGA. AntCat AntWiki

Taxonomic history

Imai, Kubota, et al. 1985: 47 (k.).
Senior synonym of Tetramorium subscabrum: Bolton, 1977 PDF: 102.
See also: Mayr, 1870, T. scabrum Mayr, 1879 sp.rev., T. manobo (Calilung, 2000) (Hymenoptera: Formicidae) – three good species. Myrmecologische Nachrichten 8:181-191. [2006-09]">Schlick-Steiner, Steiner & Zettel, 2006 PDF: 182; Mayr (Hymenoptera: Formicidae) in the Malagasy region—introduction, definition of species groups, and revision of the T. bicarinatum, T. obesum, T. sericeiventre and T. tosii species groups. Zootaxa 3039:1-72. [2011-09-22]">Hita Garcia & Fisher, 2011 PDF: 24.
Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=tetramorium&name=pacificum&rank=species

Distribution:

Islands of Leyte, Luzon, Mindanao, Negros, Romblon

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=tetramorium&name=pacificum&rank=species

Taxonomic Treatment:

Forel, A., 1912:
 . Pilam.
  Emery, C., 1893:
 - Kandy, Colombo.
  Le pedicule de l'abdomen est beaucoup moins comprime que chez le type des iles Tonga (exemplaire provenant du Museum Godeffroy) et plus fortement rugueux; la base de l'abdomen est plus fortement striee: toutefois ces caracteres ne sont pas aussi prononces que chez T. scabrum Mayr (1) auquel cette forme fait passage. La couleur est d'un brun fonce ou noire; avec les mandibules, les trochanters, les genoux et les tarses d'un brun clair.
 J'ai recu de M. Andre une de la Nouvelle-Caledonie qui ressemble beaucoup a celles de Ceylan.
  Ward, P. S., 2005:
 I [introduced species]
  Bolton, B., 1979:
 (Fig. 44)
 Tetramorium pacificum Mayr , 1870: 972, 976. Syntype workers, female, Tonga: Tongatabu (BMNH; NM, Vienna) [examined]. [For a statement of current synonymy oi pacificum see Bolton, 1977: 102.]
 Worker. TL 3.7 - 4.6, HL 0.86 - 1.10, HW 0.72 - 1.02, CI 83 - 90, SL 0.62 - 0.82, SI 79 - 87, PW 0.54 - 0.68, AL 1.04 - 1.30 (45 measured).
 Mandibles usually unsculptured except for hair-pits but in some populations with feeble traces of striation. Anterior clypeal margin with a median notch or impression; median portion of clypeus with three strong longitudinal carinae. Frontal carinae long and strongly developed, usually approaching the occipital margin. Maximum diameter of eye c. 0.18 - 0.21, about 0.22 - 0.25 x HW. Propodeal spines long and acute, usually narrow and often somewhat upcurved along their length. Metapleural lobes acute and upcurved, usually broad. Petiole in profile characteristically shaped (Fig. 44), with the posterior face higher than the anterior so that the convex dorsum slopes upwards posteriorly and the posterodorsal angle is higher than the anterodorsal. Anterior face and dorsum confluent through a curve. Sculpture variable in density and intensity. On the head varying from a blanketing rugoreticulum to a system which is predominantly longitudinal but with cross-meshes present from the level of the anterior margins of the eyes; always with a reticulum posteriorly, close to the occiput. Ground-sculpture between rugae superficial but quite conspicuous. Dorsal alitrunk reticulate-rugose; often pedicel segments similarly sculptured but in some the sculpture predominantly longitudinal. First gastral tergite usually with at least traces of basal costulae; although these are often vestigial they are only rarely completely absent. Erect or suberect long hairs numerous on all dorsal surfaces of head and body. Colour a uniform dark brown, blackish brown or black.
 T. pacificum ranges throughout the Oriental and Indo-Australian regions and occurs in northern Australia. It is very widespread in most or all of the island-systems of the Pacific (Wilson & Taylor, 1967; Bolton, 1977) and has been recorded from California in the U. S. A. (M. R. Smith, 1943 ; Creighton, 1950). The shape of the petiole in pacificum is unique amongst tetramoriines occurring in the New World and should serve to identify instantly this species.
 

Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=tetramorium&name=pacificum&rank=species

I [introduced species]

License
Rights holder/AuthorNo known copyright restrictions
Sourcehttp://antbase.org/ants/publications/21008/21008.pdf

(Fig. 44)

 

Tetramorium pacificum Mayr , 1870: 972, 976. Syntype workers, female, Tonga: Tongatabu (BMNH; NM, Vienna) [examined]. [For a statement of current synonymy oi pacificum see Bolton, 1977: 102.]

 

Worker. TL 3.7 - 4.6, HL 0.86 - 1.10, HW 0.72 - 1.02, CI 83 - 90, SL 0.62 - 0.82, SI 79 - 87, PW 0.54 - 0.68, AL 1.04 - 1.30 (45 measured).

 

Mandibles usually unsculptured except for hair-pits but in some populations with feeble traces of striation. Anterior clypeal margin with a median notch or impression; median portion of clypeus with three strong longitudinal carinae. Frontal carinae long and strongly developed, usually approaching the occipital margin. Maximum diameter of eye c. 0.18 - 0.21, about 0.22 - 0.25 x HW. Propodeal spines long and acute, usually narrow and often somewhat upcurved along their length. Metapleural lobes acute and upcurved, usually broad. Petiole in profile characteristically shaped (Fig. 44), with the posterior face higher than the anterior so that the convex dorsum slopes upwards posteriorly and the posterodorsal angle is higher than the anterodorsal. Anterior face and dorsum confluent through a curve. Sculpture variable in density and intensity. On the head varying from a blanketing rugoreticulum to a system which is predominantly longitudinal but with cross-meshes present from the level of the anterior margins of the eyes; always with a reticulum posteriorly, close to the occiput. Ground-sculpture between rugae superficial but quite conspicuous. Dorsal alitrunk reticulate-rugose; often pedicel segments similarly sculptured but in some the sculpture predominantly longitudinal. First gastral tergite usually with at least traces of basal costulae; although these are often vestigial they are only rarely completely absent. Erect or suberect long hairs numerous on all dorsal surfaces of head and body. Colour a uniform dark brown, blackish brown or black.

 

T. pacificum ranges throughout the Oriental and Indo-Australian regions and occurs in northern Australia. It is very widespread in most or all of the island-systems of the Pacific (Wilson & Taylor, 1967; Bolton, 1977) and has been recorded from California in the U. S. A. (M. R. Smith, 1943 ; Creighton, 1950). The shape of the petiole in pacificum is unique amongst tetramoriines occurring in the New World and should serve to identify instantly this species.

License
Rights holder/AuthorNo known copyright restrictions
Sourcehttp://atbi.biosci.ohio-state.edu/HymOnline/reference-full.html?id=6435

Statistics of barcoding coverage: Tetramorium pacificum:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 40
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=52700

Barcode data: Tetramorium pacificum:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATNANGTATTTTTTATTTGCTATTTGAGCCNGAATAATCGGATCTTCAATNANAATAATTATTCGACTAGAATTAGGATCATGTAACTCAATTATCAATAATGATCAAGTATATAATACTTTAATCACAAGACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGTGGATTTGGAAATTTTTTAATCCCACTAATACTCGGAACTCCAGATATAGCCTACCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCATCTATTATATTATTATTATTTAGAAGATTTATTAATATAGGGGTAGGAACAGGCTGAACTATTTATCCCCCACTAGCTTCAAATATATTTCATAGGGGGCCTTCAGTAGATATATCAATTTTCTCTCTTCATATTGCCGGTATATCGTCCATTTTAGGGGCAATTAATTTTATCTCCACTATTTTAAATATACACCACAAAAAATTATCCTTAGATAAGATCCCACTATTAGTATGATCTATTCTAATCACAGCAATCCTTTTATTACTATCATTACCAGTACTGGCAGGAGCAATTACTATACTTTTAACAGACCGAAACCTAAACACNTCATTTTTTGACCCATCNGGGGGGGGAGACCCTATCCTATATCAACACTTATTT
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=52700

Tetramorium pacificum is a medium-sized dark colored ant that is most often encountered on vegetation. This species has a monomorphic worker caste with 12-segmented antennae, three-segmented antennal club, antennal scrobes, short antennal scapes that do not surpass the posterior margin of the head, a gradually sloped mesosoma, and strong propodeal spines. Like all myrmicines, T. pacificum has two waist segments and a gaster armed with a stinger. Tetramorium pacificum has established populations outside of its native range, but it is not believed to cause significant damage to ecological or agricultural systems. The species is most often encountered on vegetation in disturbed or edge forest habitat.

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/content/tetramorium-pacificum-1

Tetramorium pacificum Mayr HNS

(Fig. 44)

Tetramorium pacificum Mayr HNS , 1870: 972, 976. Syntype workers, female, Tonga: Tongatabu (BMNH; NM, Vienna) [examined]. [For a statement of current synonymy oi pacificum HNS see Bolton, 1977: 102.]

Worker. TL 3.7 - 4.6, HL 0.86 - 1.10, HW 0.72 - 1.02, CI 83 - 90, SL 0.62 - 0.82, SI 79 - 87, PW 0.54 - 0.68, AL 1.04 - 1.30 (45 measured).

Mandibles usually unsculptured except for hair-pits but in some populations with feeble traces of striation. Anterior clypeal margin with a median notch or impression; median portion of clypeus with three strong longitudinal carinae. Frontal carinae long and strongly developed, usually approaching the occipital margin. Maximum diameter of eye c. 0.18 - 0.21, about 0.22 - 0.25 x HW. Propodeal spines long and acute, usually narrow and often somewhat upcurved along their length. Metapleural lobes acute and upcurved, usually broad. Petiole in profile characteristically shaped (Fig. 44), with the posterior face higher than the anterior so that the convex dorsum slopes upwards posteriorly and the posterodorsal angle is higher than the anterodorsal. Anterior face and dorsum confluent through a curve. Sculpture variable in density and intensity. On the head varying from a blanketing rugoreticulum to a system which is predominantly longitudinal but with cross-meshes present from the level of the anterior margins of the eyes; always with a reticulum posteriorly, close to the occiput. Ground-sculpture between rugae superficial but quite conspicuous. Dorsal alitrunk reticulate-rugose; often pedicel segments similarly sculptured but in some the sculpture predominantly longitudinal. First gastral tergite usually with at least traces of basal costulae; although these are often vestigial they are only rarely completely absent. Erect or suberect long hairs numerous on all dorsal surfaces of head and body. Colour a uniform dark brown, blackish brown or black.

T. pacificum HNS ranges throughout the Oriental and Indo-Australian regions and occurs in northern Australia. It is very widespread in most or all of the island-systems of the Pacific (Wilson & Taylor, 1967; Bolton, 1977) and has been recorded from California in the U. S. A. (M. R. Smith, 1943 ; Creighton, 1950). The shape of the petiole in pacificum HNS is unique amongst tetramoriines occurring in the New World and should serve to identify instantly this species.

  • Bolton, B. (1979): The ant tribe Tetramoriini (Hymenoptera: Formicidae). The genus Tetramorium Mayr in the Malagasy region and in the New World. Bulletin of the British Museum (Natural History) Entomology 38, 129-181: 168-168, URL:http://atbi.biosci.ohio-state.edu/HymOnline/reference-full.html?id=6435
LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/1628FB26DF3C237F9A0E2CC5C5247133

Tetramorium pacificum Mayr HNS 1870b

I [introduced species]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/C87B42CBDE96C0655866C2D0CACF49D9
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith