Technomyrmex pallipes (Smith, F. 1876)

主标签

EOL Text

Statistics of barcoding coverage: Technomyrmex pallipes:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 66
Species With Barcodes: 1

许可证http://creativecommons.org/licenses/by/3.0/
权利人/作者Sujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
源http://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=52711

Barcode data: Technomyrmex pallipes:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTATAATTGGTGGATTTGGAAATTTTCTGGTACCTTTAATA---CTAGGAGCCCCTGATATAGCCTACCCACGATTAAATAATATAAGATTTTGATTACTCCCACCTTCTATTATTTTATTAACAACCAGAAATTTTATTAGAATAGGTGTAGGAACTGGTTGAACTGTCTACCCCCCTTTATCTTCAAATATTTATCATAACGGACCATCTGTAGATTTA---GCTATTTTTTCCCTTCATATTGCTGGAATATCATCTATCCTAGGTGCAATCAATTTTATCTCAACTATTTTAAATATACATCATAAAAATTTATCTTTAGATAAAATCCCCCTATTAGTATGATCTATTCTTATTACAGCTATCCTCTTACTTCTATCCCTACCTGTATTAGCAGGA---GCAATCACTATACTCCTAACAGATCGAAATATTAACACCTCATTTTTTGACCCAAGGGGAGGAGGAGACCCAATCTTATATCAACATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATCTTAATTTTACCAGGATTTGGATTAATTTCCCATATTATCATAAATGAAAGAGGGAAAAAA---GAAACATTTGGGTCCCTAGGTATAATTTATGCTATAATCTCTATTGGATTTTTAGGATTTATTGTTTGAGCACATCATATATTTACCATTGGTCTAGATGTAGATACACGAGCTTATTTTACCTCAGCAACTATAATTATTGCTATCCCCACTGGCATTAAAATTTTTAGATGAATTACT---ACTCTACACGGATCA---AAAATTAATTACAACCCAACTTTATGATGATCAATAGGATTTATTTTTTTATTTACCTTAGGCGGATTAACTGGAATTATATTATCAAATTCATCAATTGATATTATCCTC
-- end --


Download FASTA File

许可证http://creativecommons.org/licenses/by/3.0/
权利人/作者Sujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
源http://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=52711

Diagnosis among workers of introduced and commonly intercepted species. Antenna 12-segmented. Antennal scape length less than 1.5x head length. Eyes medium to large (greater than 5 facets); eye length not distinctly greater than length of cephalic hair. Antennal sockets and posterior clypeal margin separated by a distance less than the minimum width of antennal scape. Mandible lacking distinct basal angle. Dorsum of mesosoma with metanotal groove, but never with a deep and broad concavity; erect hairs present. Propodeum and petiolar node both lacking a pair of short teeth. Propodeum lacking posteriorly projecting protrusion; with dorsal surface distinctly shorter than posterior face. Waist 1-segmented (may be hidden by gaster). Petiolar node appearing flattened. Gaster armed with ventral slit; with five plates on its dorsal surface. Distinct constriction not visible between abdominal segments 3+4. Dorsum of head with 2 pairs of short and stubby hairs posterior to eye. Pronotum with 1–3 pairs of erect hairs. Mesonotum with erect hairs. Propodeum with 2 (rarely 3) pairs of erect hairs. Color uniformly dull brown; hind tarsus not distinctly lighter in color than hind femur.

Technomyrmex pallipes can be distinguished from Brachymyrmex species, with which it bears superficial resemblance, by the 12-segmented (versus 9-segmented) antenna, and by the presence of a ventral slit (versus acidopore) on the gaster tip. It can be differentiated from Technomyrmex species by the absence (versus presence) or erect hairs on the mesosoma, and by the gaster which has 4 plates on the dorsal surface and 6 on the ventral surface (versus 5 plates on both surfaces). It is most easily differentiated from Tapinoma sessile by the bicolored with dark head and light body, gaster and appendages (versus uniform brown color). Technomyrmex pallipes is distinguished from its fellow introduced congeners by the following combination of characters: (1) Dorsum of head with 2 pairs of short and stubby hairs posterior to eye; (2) 1–3 pairs of erect hairs on pronotum, 2 pairs on propodeum, erect hairs present on mesonotum; (3) hind tarsus not distinctly lighter in color than hind femur. This last character is the easiest way to separate T. pallipes from its fellow introduced congeners.

许可证http://creativecommons.org/licenses/by-sa/3.0/
权利人/作者Eli Sarnat, Antkey
源http://antkey.org/content/technomyrmex-pallipes-1

Brachymyrmex, Tapinoma sessile, Technomyrmex albipes, Technomyrmex difficilis, Technomyrmex vitiensis

许可证http://creativecommons.org/licenses/by-sa/3.0/
权利人/作者Eli Sarnat, Antkey
源http://antkey.org/node/32687

Technomyrmex pallipes HNS (F. Smith, 1876)

(Fig. 6)

Tramp species, in hothouses, Palaearctic, potentially to be imported to the New World.

许可证Public Domain
权利人/作者No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
源http://treatment.plazi.org/id/F0021DFE124C7FD537D1924E12D29815

Technomyrmex pallipes (F. Smith) HNS comb. n.

(Fig. 4)

Tapinoma pallipes Smith HNS , F. 1876: 447. Syntype workers, ROGRIGUEZ I. (BMNH) [examined]. [Misspelled as pallidipes HNS by Dalla Torre, 1893: 166.]

Technomyrmex albipes subsp. foreli Emery HNS , 1893: 249. Syntype workers, MADAGASCAR: Tamatave (MHNG) [examined], Syn.n.

Technomyrmex atrichosus Viehmeyer HNS , 1922: 214. Syntype workers, KENYA: Shirati, v. 1909 (Katona) (ZMHB) [examined]. Syn. n. (See note.)

Technomyrmex foreli var. affinis HNS Santschi, 1930a: 71. [First available use of Technomyrmex albipes st. foreli var. affinis HNS Santschi, 1914: 119 (unavailable name).] Syntype workers, KENYA ("Afr. Or. Angl."): Naivasha, Dec. 1911, 1900 m, st. 14, no. 694/14 (Alluaud & Jeannel) (MHNG) [examined]. Syn. n.

Technomyrmex brevicornis HNS Santschi, 1930a: 71, figs. 34 - 36. Syntype workers, ANGOLA: S.P. de Loanda, 24.ii.1913 (Silvestri) (syntypes are labeled Technomyrmex foreli brevicornis ) (NHMB) [examined]. Syn. n.

Technomyrmex albipes subsp. truncicolus Weber HNS , 1943: 380. Syntype workers, SUDAN: Equatoria , Imatong Mts, 6200 ft, 24.vii. - 5.viii.1939, No. 1382 (N.A. Weber) (MCZC) [examined] Syn. n.

Technomyrmex primroseae Donisthorpe HNS , 1949: 273. Holotype and paratype workers, MAURITIUS: Le Pouce Mt, 2.xi.l948, no.126 (R. Mamet) (BMNH) [examined]. Syn. n.

NOTE

The two syntype workers of atrichosus HNS are extremely abraded specimens of pallipes HNS on which very few of the diagnostic setae remain. However, nineteen more workers from the same series, not considered in the original description, are preserved in HNHM. All of these are also extremely abraded, but summing all the setae that remain on these specimens gives the characteristic setal array of pallipes HNS .

WORKER. Measurements: TL 2.3 - 2.8, HL 0.52 - 0.68, HW 0.46 - 0.64, SL 0.45 - 0.64, PW 0.33 - 0.37, WL 0.65 - 0.72 (30 measured). Indices: CI 84 - 94, SI 92 - 106, OI 28 - 33, EPI 55 - 71, DTI 120 - 128.

Frontal carina with 2 setae: in profile the anterior above the torulus, the posterior at the level of the anterior portion of the eye; both of these shorter than the maximum diameter of the eye. No seta present at level of posterior margin of eye. Posterior to this the dorsum with 2 pairs of inconspicuous, extremely short stubbly setae, both of which are less than half the length of the seta above the eye: anterior pair about midway between level of posterior margin of eye and posterior margin of head, posterior pair very close to or at the posterior margin (easily abraded). In full-face view median portion of anterior clypeal margin extremely shallowly concave or feebly indented; posterior margin of head at most very slightly concave or impressed medially, sometimes almost transverse. Eyes relatively large and located in front of midlength, EPI <80; in full-face view outer margins of eyes touch, or more usually break, the outline of the sides. Number of setal pairs on dorsal mesosoma: pronotum 1 - 3, shorter than maximum diameter of eye; mesonotum 1, about half the length of the pronotal setae and located at the point where the slope of the mesonotal dorsum changes; propodeal dorsum 0; lateral margins of propodeal declivity 2 (rarely 3), above the level of the spiracle. With mesosoma in profile the posterior one - third of the mesonotum is more steeply sloped than the anterior two - thirds. Metanotal groove distinct but only shallowly impressed. Dorsum of propodeum short and more or less flat, meeting the steeply sloped declivity in a blunted angle. Gastral tergites 1 - 4 each with numerous setae, distributed everywhere on the sclerites; usually all are distinctly shorter than the maximum diameter of the eye. Head, mesosoma and gaster uniformly light brown to uniformly black, with all shades attested between these extremes; sometimes the gaster is slightly darker than the mesosoma. Legs lighter than head and body, varying from pale yellow to dull brownish yellow. Tibiae and tarsi are always the same colour, the former never considerably darker than the latter; femora may be somewhat darker, in whole or in part, than the tibiae.

The arrangement of setae and their relative lengths is characteristic of this small but relatively large - eyed species. A similar arrangement is seen only in the closely related vapidus of Kenya and Tanzania, but that species is larger, brightly coloured, and has more posteriorly located eyes.

A series of intercastes is present between worker and queen in which 0, 1 or 3 ocelli are developed and the mesosoma gradually increases in size and complexity. The mesonotum gradually differentiates into mesoscutum and mesoscutellum and in larger individuals a small prominent metanotum is also developed. Ergatoid males are produced as well as alate males and queens.

T. pallipes HNS is a common and very widely distributed species in the Afrotropical and Malagasy regions, and is present as an introduction on the Atlantic islands off Africa. It has also been recorded from hothouses, and once from a dwelling, in the West Palaearctic. Nest sites appear opportunistic, being constructed in the ground under stones, in or under rotten wood, under the bark of living trees, in rotten parts of standing trees and in hollow stems and twigs of plants. The species efficiently colonises areas disturbed by human activities and may be prevalent in plantations of tree and shrub crops. In Madagascar it is common in parks and gardens and in South Africa it is known to invade houses, where it may nest in bizarre locations such as electricity transformers or light fixtures. In other countries it has been recorded as entering houses in search of sugary food or water. Foraging is carried out both terrestrially and arboreally. When foraging on shrubs and trees pallipes tends a wide range of homopterous insects. The species called albipes in Samways, Nell & Prins (1982V associated with outbreaks of red scale on citrus in South Africa, is most probably pallipes, as also is the species referred to as albipes by Prins, Robertson & Prins (1990) in their synopsis of pest ants of South Africa.

MATERIAL EXAMINED

Ghana: Tafo (C. Campbell); Legon (D. Leston); Abodum (D. Leston); Bunso (R. Belshaw); Mankrang For. Res., nr Akomodan (R. Belshaw). Cameroun: Mkoemvon (D. Jackson). Gabon: Prov. Ogooue-Maritime, Res. Monts Doudou (B.L. Fisher); Prov. Woleu-Ntem, Minvoul (B.L. Fisher). Central African Republic: P.N. Dzanga-Ndoki (B.L. Fisher); P.N. Dzanga-Ndoki (S. van Noort); Res. Dzanga-Sangha (S. van Noort). Democratic Republic of Congo: Luebo, Macaco (H. Schouteden). Angola: Loanda (Silvestri); Sangave (Monard). Ethiopia: Ilubador Region, Buno Bedele, nr Bedele (Sforzi & Bartolozzi). Somalia: Kisimaio (Bartolozzi); Boramo (E.F. Peck). Sudan: Equatoria, Imatong Mts (N.A. Weber); Kouloubu (Andrieu). Kenya: Narok, Loita Hills (Mahnert & Perret); Naivasha (Alluaud & Jeannel); Laikipia Distr., Mpala Res. Centre (R.R. Snelling); nr Mpala Res. Centre, Ewaso Ng'iro Riv. (R.R. Snelling); Mpala Res. Centre (S. Kamande); Mpala Ranch, Hippo Pool (R.R. Snelling); Nyeri Distr., Mweiga (C.C. Hogue); Shirati (Katona); Kiambu (R.H. Le Pelley). Uganda: Bulucbebe (H. Hargreaves); Bushenyi Distr., Kalinzu Forest (S. Yamane). Tanzania: Maramba (A.M. Varela); Zanzibar, Selem (M.J. Way); Mkomazi Game Res., Kisima Mt. (H.G. Robertson); Mkomazi Game Res., Dindera Dam (A. Russell - Smith); Mkomazi Game Res., Ibaya Camp (S. van Noort); Chambezi (Lohr); Kanga (Lohr). Zambia: Lusaka (R.A. Beaver). Mozambique: Vila Manica (Ross & Leech); Zimbabwe: Bulawayo (G. Arnold); Bulawayo, Bunthorne Mine (G. Arnold); Matopos (G. Arnold); Chirinda For. (G. Arnold); Springvale (G. Arnold); Harare, Highlands (M. Cumming); Harare (A. Watsham); Zambesi Valley, 7km SE Angwa Bridge (J. Weyrich); Kanyati Wildlife Area (A.J. Gardiner); Cecil Kop, nr Umtali (W.L.Brown). Botswana: Serowe (P. Forchhammer); Okavango Delta, Shorobe (A. Russell - Smith); Maxwee (A. Russell - Smith). South Africa: Cape Prov., Suurberg (A.C. Wild); Koeberg (H.G. Robertson); Fort Beaufort (J.C Faure); Pretoria (J.C. Faure); Salique (J.C. Faure); CP., Fish Hoek (T. Ferreira); Kenilworth (M. Raven); C.P., Tsitsikamma N.P. (R.B. Kimsey); Grahamstown Bot. Gadns (C. Zachariades); Potberg (H.G. Robertson); Fernkloof Nat. Res. (H.G. Robertson); Cape of Good Hope Nat. Res. (H.G. Robertson); Cape of Good Hope Nat. Res. (M.H. Troskie); Cape of Good Hope Nat. Res. (F. Parker); Cape Pen. N.P. (F. Parker); W Cape, Le Roux's Farm (L.L. Chaane); S Cape, Wisboomskraal (W. Breytenbach); De Hoop Nat. Res. (T. Smulian); Wuppertal, Cedarberg (H.G. Robertson); W Cape, Rondevlei Nat. Res. (S. Lake); Jansenville (H. Adie); Kromrivier (H.G. Robertson); Prince Albert (Dean); Mosslands Farm (A. Bownes); Grootvadersbusch (D. Larsen); Cape Town (Philby); Kraaifontein (A.J. Prins); Natal, Illovo (P. Atkinson); Natal, Mt Edgecombe (G. Leslie); Natal, Pinetown (M. Samways); Natal, Umtamvuna Riv., Port Edward (C. Zachariades); Port Edward (C.H. Stirton); N of Richard's Bay (de Kock & Majer); Pietermaritzburg (F. Carliell); Natal, Vernon Crookes Nat. Res. (P. Caldwell); Durban, Virginia Bush (P. Caldwell); Durban, Ridgeview (P. Caldwell); KwaZulu-Natal, Karkloof (S.S. Lu); Wahroonga Farm (S.S. Lu); Mapelane Game Res. (H.G. Robertson); Jozini (H.G. Robertson); Kdumu Game Res. (H.G. Robertson); Orange Free State, Tussen Die Riviere (H.G. Robertson); Transvaal, Giyani, S. Letaba Riv. (H.G. Robertson); Tvl., Nelspruit (M. Samways); Tvl., Nyalele Vailey (Vernay - Lang); Tvl., Klipriviersberg (H.G. Robertson); Kruger Nat. Pk (A.J. Prins); Tvl., Weltevreden Farm (H.G. Robertson); Tvl, Blyderivierspoort (R.B. Kimsey); NW Prov., Pilansberg Nat. Pk (C.L. Parr). Vryburg (E. Simon); Bloemfontein (E. Simon). Swaziland: Forbes Reef (P.S. Ward). Lesotho: Maqalito (R. Tiali); Molomo (R. Tiali). Namibia: Namib Naukluft Pk, Gobabeb (H.G. Robertson); Waterberg Rest Camp (H.G. Robertson). Madagascar: Prov. Antsiranana, N Joffreville (Schlinger et al); Antsiranana, P.N. Montagne d'Ambre (R. Harin'Hala); P.N. Montagne d'Ambre (Schlinger et al); Antsiranana, Ambondrobe, Vohemar (B.L. Fisher); Antsiranana, Res. Analamerana, Anivorano-Nord (B.L. Fisher); Prov. Fianarantsoa, P.N. Isalo, Ambovo Springs (B.L. Fisher); nr Isalo P.N. (R. Harin'Hala); Fianarantsoa, SSW Ambositra, Ankazomivady (B.L. Fisher); Fianarantsoa, P.N. Andringitra, For. Ravaro (S. Razafimandimby); Fianarantsoa, For. Analalava, W. Ranohira (Fisher et al); Fianarantsoa, P.N. Ranomafana (R. Harin'Hala); Fianaranrsoa, For. Ambalagoavy Nord (R. Harin'Hala); Prov. Mahajanga, For. Ambohimanga, Mampikony ( Fisher et al); Prov. Toamasina, Andrasibe P.N. (R. Harin'Hala); Ankazomivady, SSW Ambositra (H.G. Robertson); Toamasina, W Morarano - Chrome (A. Pauly); Prov. Toliara, Res. Cap. Sainte Marie, W. Marovato (B.L. Fisher); Toliara, Ranobe (no collector's name); Toliara, P.N. Andohahela, ENE Tsimelahy (Fisher et al.); P.N. Andohahela, Manantalinjo (Fisher et al.); Toliara, For. Mite, WNW Tongobory (Fisher at al); Toliara, Res. Berenty, For. Bealoka, NNW Ambosary (Fisher et al); Toliara, P.N. Zombitse, E Sakaraha (Fisher et at); Toliara, P.N. Tsimanampetsotsa, Bemanateza (Fisher et al.); Toliara, Res Berenty, For. Malaza, NW Amboasary (Fisher et al.); Toliara, Mahafaly, nr Eloeste (V. & B. Roth); Toliara, Sept Lacs (M.G.F.); Toliara, Res. Ambohijanahary, NW Ambaravaranala (Fisher et al.); Nosi-Be (Voeltzkow); Tamatave (no collector's name); Antananarivo (P.S.Ward); 3 km. W Ranomafana, nr Ifanadiana (P.S. Ward); Res. Ankarana, 7 km. SE Matsaborimanga (P.S. Ward). Rodriguez I. (no collector's name). Mauritius: Le Pouce Mt. (R. Mamet); Corps de Garde Mt. (R. Mamet); Round I. (C. Duck); no loc. (J.E.M. Brown). Réunion I.: Bretagne (J.R. Williams). Madeira: Funchal (Silva & Wetterer). Cape Verde Is: Sal, Sta Maria (J. Wetterer); Santiago, Porto Formosa (J. Wetterer); Santiago, INIDA (J. Wetterer); Fogo, Ponta Verde (J. Wetterer). Italy: Milano (in flat) (F. Rigato). United Kingdom: London, Kew Gdns (H. Donisthorpe); Aberdeen (M. Show).

许可证Public Domain
权利人/作者No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
源http://treatment.plazi.org/id/60C7E0554B46B392A34D814F32409651

Diagnosis among workers of introduced and commonly intercepted species. Antenna 12-segmented. Antennal scape length less than 1.5x head length. Eyes medium to large (greater than 5 facets); eye length not distinctly greater than length of cephalic hair. Antennal sockets and posterior clypeal margin separated by a distance less than the minimum width of antennal scape. Mandible lacking distinct basal angle. Dorsum of mesosoma with metanotal groove, but never with a deep and broad concavity; erect hairs present. Propodeum and petiolar node both lacking a pair of short teeth. Propodeum lacking posteriorly projecting protrusion; with dorsal surface distinctly shorter than posterior face. Waist 1-segmented (may be hidden by gaster). Petiolar node appearing flattened. Gaster armed with ventral slit; with five plates on its dorsal surface. Distinct constriction not visible between abdominal segments 3+4. Dorsum of head with 2 pairs of short and stubby hairs posterior to eye. Pronotum with 1–3 pairs of erect hairs. Mesonotum with erect hairs. Propodeum with 2 (rarely 3) pairs of erect hairs. Color uniformly dull brown; hind tarsus not distinctly lighter in color than hind femur.

Technomyrmex pallipes can be distinguished from Brachymyrmex species, with which it bears superficial resemblance, by the 12-segmented (versus 9-segmented) antenna, and by the presence of a ventral slit (versus acidopore) on the gaster tip. It can be differentiated from Technomyrmex species by the absence (versus presence) or erect hairs on the mesosoma, and by the gaster which has 4 plates on the dorsal surface and 6 on the ventral surface (versus 5 plates on both surfaces). It is most easily differentiated from Tapinoma sessile by the bicolored with dark head and light body, gaster and appendages (versus uniform brown color). Technomyrmex pallipes is distinguished from its fellow introduced congeners by the following combination of characters: (1) Dorsum of head with 2 pairs of short and stubby hairs posterior to eye; (2) 1–3 pairs of erect hairs on pronotum, 2 pairs on propodeum, erect hairs present on mesonotum; (3) hind tarsus not distinctly lighter in color than hind femur. This last character is the easiest way to separate T. pallipes from its fellow introduced congeners.

许可证http://creativecommons.org/licenses/by-sa/3.0/
权利人/作者Eli Sarnat, Antkey
源http://antkey.org/node/32687

Taxonomic History:

pallipes. Tapinoma pallipes Smith, F. 1876a: 447 (w.) MAURITIUS (Rodrigues I.). [Misspelled as pallidipes by Dalla Torre, 1893: 166.] Combination in Technomyrmex: Bolton, 2007a: 56. Senior synonym of affinis, atrichosus, brevicornis, foreli, primroseae, truncicolus: Bolton, 2007a: 56.

许可证http://creativecommons.org/licenses/by-nc-sa/1.0/
权利人/作者AntWeb
源http://www.antweb.org/description.do?genus=technomyrmex&name=pallipes&rank=species

Taxonomic History:
Tapinoma pallipes Smith, 1876a PDF: 447 (w.) MAURITIUS (Rodrigues I.). AntCat AntWiki

Taxonomic history

[Misspelled as Technomyrmex pallidipes by Dalla Torre, 1893: 166.].
Combination in Technomyrmex: Bolton, 2007B PDF: 56.
Senior synonym of Technomyrmex affinis, Technomyrmex atrichosus, Technomyrmex brevicornis, Technomyrmex foreli, Technomyrmex primroseae, Technomyrmex truncicolus: Bolton, 2007B PDF: 56.
许可证http://creativecommons.org/licenses/by-nc-sa/1.0/
权利人/作者AntWeb
源http://www.antweb.org/description.do?genus=technomyrmex&name=pallipes&rank=species

Distribution:

Reference for Kenya if not type: Kakamega Forest

许可证http://creativecommons.org/licenses/by-nc-sa/1.0/
权利人/作者AntWeb
源http://www.antweb.org/description.do?genus=technomyrmex&name=pallipes&rank=species
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith